View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_45 (Length: 304)
Name: NF20764_high_45
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 38808488 - 38808323
Alignment:
| Q |
18 |
ttaatttcaccagctcgtgtaaaaagctcgtaaatttgctcttccgtagtgtaaaacgacatgttcccaacgtaaacggtggttgaagttttaagcgcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38808488 |
ttaatttcaccagctcgtgtaaaaagctcgtaaatttgctcttccgtagtgtaaaacgacatgttcccaacgtaaacggtggttgaagttttaagcgcat |
38808389 |
T |
 |
| Q |
118 |
gctcaaattcttcttgatttccagggaatcttctatctctgtatgccgagatcttcgccggatcct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38808388 |
gctcaaattcttcttgatttccagggaatcttctatctctgtatgccgagatcttcgccggatcct |
38808323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 249 - 294
Target Start/End: Complemental strand, 38808257 - 38808212
Alignment:
| Q |
249 |
taatagagtttaatagtgtaccttgaataacaacgcctttgctact |
294 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
38808257 |
taatagagttgaatagtgtaccttgaataacaacgccattgttact |
38808212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University