View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_52 (Length: 298)
Name: NF20764_high_52
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 279
Target Start/End: Complemental strand, 33175138 - 33174868
Alignment:
| Q |
14 |
aaataaattagccaatatcatgac-----tgtattacaattacataaaacatttatagttgaagaaaaatttaaattagnnnnnnnntaaagaacttgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
33175138 |
aaataaattagccaatatcatgacgtccctgtattacaattacataaaacatttatagttgaagaaaaatttgaattagaaaaaaaataaagaacttgaa |
33175039 |
T |
 |
| Q |
109 |
tgaataattaacaagtagcttaatgcatccgcaaaatttaggcccatattttgctttggtccctacggttcaaagaacacataactctttgcacctgcaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33175038 |
tgaataattaacaagtagcttaatgcatccgcaaaatttaggcccatattttgctttggtccctacggttcaaagaacacataactctttgcacctgcaa |
33174939 |
T |
 |
| Q |
209 |
gtaggcgttgcaattgttcatcgtcctccaatcacattcatgtcattccaatgcaaattggaagaagtagg |
279 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33174938 |
gtaggcgttgcaattgttcatcgtcctacaatcacattcatgtcattccaatgcaaattggaagaagtagg |
33174868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University