View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20764_high_62 (Length: 277)

Name: NF20764_high_62
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20764_high_62
NF20764_high_62
[»] chr7 (1 HSPs)
chr7 (177-260)||(25788892-25788975)


Alignment Details
Target: chr7 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 25788892 - 25788975
Alignment:
177 tattcccaagtgtttgacaaaaaggaatagtacactcagagtactaaatcttgctggaaacaagctcacaggttatgtttctga 260  Q
    |||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25788892 tatttccaagtgtttaataaaaaggaatagtacactcagagtactaaatcttgctggaaacaagctcacaggttatgtttctga 25788975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University