View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_63 (Length: 274)
Name: NF20764_high_63
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 258
Target Start/End: Complemental strand, 19506690 - 19506445
Alignment:
| Q |
13 |
aatataagtaaatgaggattagaaataacctttaatggaagcaagtaacgaatgtacatgtatctttggaagctattcatgttttccaatactgtaactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
19506690 |
aatataagtaaatgaggattagaaataacctttaatggaagcaagtaacgaatgtacatgtatctttggaagctattcatattttccaataccgtaactt |
19506591 |
T |
 |
| Q |
113 |
taccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagctgtagtctctgagactctcatatctcactggattccc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506590 |
taccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagcagtagtctctgagactctcatatctcactggattccc |
19506491 |
T |
 |
| Q |
213 |
aacagatgaacccacatgatatatgctatcatcacaaggttgattt |
258 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19506490 |
aacagatgaacctacgtgatatatgctatcatcacaaggttgattt |
19506445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University