View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_65 (Length: 258)
Name: NF20764_high_65
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 188 - 250
Target Start/End: Original strand, 4673593 - 4673655
Alignment:
| Q |
188 |
gaatctttaattatatctaacgtacttggacttgatctggatggtttctttggtgcggctttc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673593 |
gaatctttaattatatctaacgtacttggacttgatctggatggtttctttggtgcggctttc |
4673655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 81 - 114
Target Start/End: Original strand, 4673487 - 4673520
Alignment:
| Q |
81 |
ctattaaaaaataaattaatataaccgactggcg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
4673487 |
ctattaaaaaataaattaatataaccgaccggcg |
4673520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University