View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_high_79 (Length: 247)
Name: NF20764_high_79
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_high_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 22 - 236
Target Start/End: Original strand, 41848433 - 41848647
Alignment:
| Q |
22 |
actctgccgtttggagagcattgaacaccatgccaggcggtgttgcaggcatcctcaccggtccagttatcgacgaggtagccgtggaagtcggttcgga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41848433 |
actctgccgtttggagagcattgaacaccatgccaggcggtgttgcaggcatcctcaccggtccagttatcgacgaggtagccgtggaagtcggttcgga |
41848532 |
T |
 |
| Q |
122 |
gacggaattcggtgagggcgtgtgtgtcattatgattatgttgtgcactttgtgttagagatggtgatgtaaagagaaatgccaaggttaaggctaatgc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41848533 |
gacggaattcggtgagggcgtgtgtgtcattatgattatgttgtgcactttgtgttagagatggtgatgtaaagagaaatgctaaggttaaggctaatgc |
41848632 |
T |
 |
| Q |
222 |
tagtgttgtgttcat |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41848633 |
tagtgttgtgttcat |
41848647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University