View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_12 (Length: 538)
Name: NF20764_low_12
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 1e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 429 - 519
Target Start/End: Original strand, 33328598 - 33328688
Alignment:
| Q |
429 |
gatgatccttactctcttccacggagtttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcagttac |
519 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33328598 |
gatgatccttactctcttccgcggaggttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcaattac |
33328688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 33328435 - 33328474
Alignment:
| Q |
14 |
gaagatgcatacgcgtggatcttgagtacataatatttca |
53 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33328435 |
gaagatgcatatgcgtggatcttgagtacataatatttca |
33328474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University