View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_16 (Length: 477)
Name: NF20764_low_16
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_16 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 1e-23; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 405 - 477
Target Start/End: Original strand, 29486884 - 29486956
Alignment:
| Q |
405 |
cttcagtatatagttcagtttgattttgcacatcagaaggactgatatcaacataaaccggaataataagtct |
477 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29486884 |
cttcactatatggtacagtttgattttgcacatcagaaggactgatatcaacataaaccggaagaataagtct |
29486956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 293 - 375
Target Start/End: Original strand, 29486805 - 29486887
Alignment:
| Q |
293 |
tacccgtgtttcaaattccaggcggacaagttagctacatgagatagagcgttcctccatttaaacaatttattcttgtcttc |
375 |
Q |
| |
|
||||| ||||| |||||||| |||| ||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
29486805 |
tacccatgtttgaaattccacgcgggcaagttagctacacgagatagagcgttcctccatttaatcaatttattattgtcttc |
29486887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 58 - 103
Target Start/End: Original strand, 29527421 - 29527466
Alignment:
| Q |
58 |
ccctgataaaccagagaggttatgttaaactaaatgcagttatttc |
103 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
29527421 |
ccctgctaaaccagagaggttaggtcaaactaaatgtagttatttc |
29527466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 29486140 - 29486192
Alignment:
| Q |
229 |
tttttgttcatgtactgagattaaattaaaatcaaaggtaacaatgttagtga |
281 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| |||||| |||||||| |
|
|
| T |
29486140 |
tttttgttcatgtactacaattaaattaaaataaaagttaacaacgttagtga |
29486192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University