View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_55 (Length: 296)
Name: NF20764_low_55
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 127 - 192
Target Start/End: Complemental strand, 1321147 - 1321082
Alignment:
| Q |
127 |
cttctcgctatttacatttccgggtatattccccacattttagcatgaactgtattacaggctcca |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1321147 |
cttctcgctatttacatttccgtgtatattccccacattttagcatgaactgtattacaggctcca |
1321082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University