View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_56 (Length: 289)
Name: NF20764_low_56
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 134 - 284
Target Start/End: Complemental strand, 28478827 - 28478680
Alignment:
| Q |
134 |
gttttagttccaagtaacatattactattattattgtctaagtacactaattacaatggctgtttcaactagtttctatggtgttaaattggaacctttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28478827 |
gttttagttccaagtaacatattactattatt---gtctaagtacactaattacaatggctgtttcaactagtttctatggtgctaaattggaacctttg |
28478731 |
T |
|
| Q |
234 |
ttccttaaatgttgttcttcttcttcaacaacatcttcctcctatgctact |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
28478730 |
ttccttaaatgttgttcttcttcttcaacaacatcttcctcttatgttact |
28478680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 28478946 - 28478884
Alignment:
| Q |
15 |
tcaaataattccaaatactttccatacgccacatcttttgccacatcatttcattattcattt |
77 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478946 |
tcaaataattccaaaaactttccatacgccacatcttttgccacatcatttcattattcattt |
28478884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University