View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_60 (Length: 286)
Name: NF20764_low_60
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 51 - 273
Target Start/End: Complemental strand, 279544 - 279322
Alignment:
| Q |
51 |
atgagtttgtgtctaacttgacgcaataatttccaaaattccaactctcatagagaggatatttcattttcaaatcatatatcaatcaaagtatgtgaaa |
150 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
279544 |
atgagtttgtgtctaacttgacacaataatttccaaaattccaactctcatagagaggatatttcattttcaaatcatatatcaatcaaagtatatgaaa |
279445 |
T |
 |
| Q |
151 |
gcgcattatttgttctttgttcgtacttcactttgttattgattcaaagctacatgtattttaacctacttgtgatttgactatttatatagggttgagg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
279444 |
acgcattatttgttctttgttcgtacttcactctgttgttgattcaaagctacatgtattttaacctacttgtgatttgactatttatatatggtcgagg |
279345 |
T |
 |
| Q |
251 |
agacggttatgtagtaattaatg |
273 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
279344 |
agacggttatgtagtaattaatg |
279322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University