View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_62 (Length: 283)
Name: NF20764_low_62
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_62 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 140 - 279
Target Start/End: Complemental strand, 26501073 - 26500935
Alignment:
| Q |
140 |
cttaatgtgatcatttttaagtgtattgtaatagtcaatatattttatttannnnnnnggaataacatgtacaattctaattaattttagtttatgcagc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26501073 |
cttaatgtgatcatttttaagtgtattgtaatattcaatatatttaatttatttttt-ggaataacatgtacaattctaattaattttagtttatgcagc |
26500975 |
T |
|
| Q |
240 |
ctaaggcagggaaaaacgtggatggtcaagattgtgagat |
279 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26500974 |
ctaaggcagtgaaaaacttggatggtcaagattgtgagat |
26500935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 26501196 - 26501099
Alignment:
| Q |
20 |
gtttaaagccatacataaattaatttatagcacaagttaattattaccgacgt-cttttttataagccctttgttatttttatatgtagcatattagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26501196 |
gtttaaagccatacataaattaatttagagcacaagttaattattaccaacgtccttttttataagccctttgttatttttatatgtagcatactagg |
26501099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University