View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_64 (Length: 277)
Name: NF20764_low_64
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 177 - 260
Target Start/End: Original strand, 25788892 - 25788975
Alignment:
| Q |
177 |
tattcccaagtgtttgacaaaaaggaatagtacactcagagtactaaatcttgctggaaacaagctcacaggttatgtttctga |
260 |
Q |
| |
|
|||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25788892 |
tatttccaagtgtttaataaaaaggaatagtacactcagagtactaaatcttgctggaaacaagctcacaggttatgtttctga |
25788975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University