View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_69 (Length: 255)
Name: NF20764_low_69
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 111 - 240
Target Start/End: Complemental strand, 24234549 - 24234418
Alignment:
| Q |
111 |
aaggaaattgttttattttcaagtaagttgtagatatctcttgcttatnnnnnnnnnnngtagtagatctctctttcac--acacgttcggcaaaagtcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
24234549 |
aaggaaattgttttattttcaagtaagttgtagatatctcttgcttataaaaaaaaaaagtagtatatttctctttcacacacacgttcggcaaaagtcc |
24234450 |
T |
 |
| Q |
209 |
aaacctaaatccaaccttcaacccgatcaaac |
240 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
24234449 |
aaacctaaatccaaccttcaatccgatcaaac |
24234418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University