View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_78 (Length: 247)
Name: NF20764_low_78
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 49407856 - 49408086
Alignment:
| Q |
1 |
atcatgcaaactattaatgaaacccaacccttctttcacaaaccaagtagactacctgcagggcagaaagttaaacaaaaatgaagactaatggatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49407856 |
atcatgcaaactattaatgaaacccaatccttctttcacaaaccaagtagactacctgcagggcagaaagttaaacaaaaatgaagactaatggatacaa |
49407955 |
T |
|
| Q |
101 |
aaggaaaggaaatcacactttcatctcaatttgaattctcttatggatcaaaaggtcacttaataccgcgacatttatgtcacaatttatgtataatttt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
49407956 |
aaggaaaggaaatcacagtttcatctcaatttgaattctcttatggatcaaaaggtcacttaataccgcgatatttatgtcacaatttatgtatgatttt |
49408055 |
T |
|
| Q |
201 |
ggctattttgcttttatgtatgtaatgtatg |
231 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
49408056 |
ggctattttgcttttacgtatgtaatgtatg |
49408086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University