View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20764_low_81 (Length: 247)

Name: NF20764_low_81
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20764_low_81
NF20764_low_81
[»] chr7 (1 HSPs)
chr7 (22-236)||(41848433-41848647)


Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 22 - 236
Target Start/End: Original strand, 41848433 - 41848647
Alignment:
22 actctgccgtttggagagcattgaacaccatgccaggcggtgttgcaggcatcctcaccggtccagttatcgacgaggtagccgtggaagtcggttcgga 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41848433 actctgccgtttggagagcattgaacaccatgccaggcggtgttgcaggcatcctcaccggtccagttatcgacgaggtagccgtggaagtcggttcgga 41848532  T
122 gacggaattcggtgagggcgtgtgtgtcattatgattatgttgtgcactttgtgttagagatggtgatgtaaagagaaatgccaaggttaaggctaatgc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
41848533 gacggaattcggtgagggcgtgtgtgtcattatgattatgttgtgcactttgtgttagagatggtgatgtaaagagaaatgctaaggttaaggctaatgc 41848632  T
222 tagtgttgtgttcat 236  Q
    |||||||||||||||    
41848633 tagtgttgtgttcat 41848647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University