View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_82 (Length: 247)
Name: NF20764_low_82
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_82 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 102 - 238
Target Start/End: Original strand, 8764507 - 8764640
Alignment:
| Q |
102 |
tggtaagcaaaaataagagcttttgatagtttataacaaatctcaggctatagcaaaggagaaaaaattatgtgtaaaattgttagaaatagagaaatta |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
8764507 |
tggtaagcaaaagtaagagcttttgatagtttataacaaatctcaggctatagcaaaggagaaaaaattatctgtaaaattgttaga---agagaaatta |
8764603 |
T |
|
| Q |
202 |
attaaatcaagaaacttgtgggaagtgtaataatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764604 |
attaaatcaagaaacttgtgggaagtgtaataatatt |
8764640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 8764412 - 8764449
Alignment:
| Q |
7 |
aaaagattgagtgttattaagcacggttcttgactact |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764412 |
aaaagattgagtgttattaagcacggttcttgactact |
8764449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University