View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_86 (Length: 235)
Name: NF20764_low_86
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 41761060 - 41760842
Alignment:
| Q |
1 |
tgctcttaccaattgttgaggagtttgaatagccagaatagaaagtggtggagtagaagatcgattgagaacaaagtcaccagccacagcaacttgagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41761060 |
tgctcttaccaattgttgaggagtttgaataacctgaatagaaagtggtggagtagaagatcgattgagaacaaagtcaccagccacagcaacttgagac |
41760961 |
T |
 |
| Q |
101 |
ttctccatagtttttgtaacagcaccactttgtgaactccataaatggtgtaggtatggaaaaggaatccaatcagaagggttaggacccgatacagaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41760960 |
ttctccatagtttttgtaacagcaccactttgtgaactccataaatggtgtaggtatggaaaaggaacccaatcagaagggttaggacccgatacagaaa |
41760861 |
T |
 |
| Q |
201 |
caagcactgcaatcactat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41760860 |
caagcactgcaatcactat |
41760842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 117
Target Start/End: Complemental strand, 41752710 - 41752674
Alignment:
| Q |
81 |
cagccacagcaacttgagacttctccatagtttttgt |
117 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
41752710 |
cagccacaacaacttgagccttctccatagtttttgt |
41752674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University