View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20764_low_96 (Length: 210)

Name: NF20764_low_96
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20764_low_96
NF20764_low_96
[»] chr4 (2 HSPs)
chr4 (18-99)||(30262749-30262830)
chr4 (125-192)||(30262683-30262750)
[»] chr3 (1 HSPs)
chr3 (57-118)||(39068985-39069046)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 30262830 - 30262749
Alignment:
18 gaaatgagaacaaaaaacgtgaaataattatgtgaatagatttttacgagtgtgtgcgcaattcatgtatctaaatccttgt 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||    
30262830 gaaatgagaacaaaaaacgtgaaataattatgtgaatagatttttacgagtgtgtgggcaattcatgtatctaaatctttgt 30262749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 30262750 - 30262683
Alignment:
125 gtaaacaaacccttaatattttatcgagaaatgtcagccatacctattttaacacactctttcttata 192  Q
    |||||||||||||||||||||||||||| |||||   ||||||||||||||||||||||||| |||||    
30262750 gtaaacaaacccttaatattttatcgagtaatgtagaccatacctattttaacacactcttttttata 30262683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 118
Target Start/End: Original strand, 39068985 - 39069046
Alignment:
57 atttttacgagtgtgtgcgcaattcatgtatctaaatccttgtgtccacacaagaattgctc 118  Q
    ||||||| |||||||||  ||| |||||| |||||||| ||  |||||||||||||||||||    
39068985 atttttatgagtgtgtgaccaaatcatgtgtctaaatctttaggtccacacaagaattgctc 39069046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University