View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20764_low_96 (Length: 210)
Name: NF20764_low_96
Description: NF20764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20764_low_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 30262830 - 30262749
Alignment:
| Q |
18 |
gaaatgagaacaaaaaacgtgaaataattatgtgaatagatttttacgagtgtgtgcgcaattcatgtatctaaatccttgt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
30262830 |
gaaatgagaacaaaaaacgtgaaataattatgtgaatagatttttacgagtgtgtgggcaattcatgtatctaaatctttgt |
30262749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 125 - 192
Target Start/End: Complemental strand, 30262750 - 30262683
Alignment:
| Q |
125 |
gtaaacaaacccttaatattttatcgagaaatgtcagccatacctattttaacacactctttcttata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
30262750 |
gtaaacaaacccttaatattttatcgagtaatgtagaccatacctattttaacacactcttttttata |
30262683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 118
Target Start/End: Original strand, 39068985 - 39069046
Alignment:
| Q |
57 |
atttttacgagtgtgtgcgcaattcatgtatctaaatccttgtgtccacacaagaattgctc |
118 |
Q |
| |
|
||||||| ||||||||| ||| |||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
39068985 |
atttttatgagtgtgtgaccaaatcatgtgtctaaatctttaggtccacacaagaattgctc |
39069046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University