View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20765_low_13 (Length: 238)
Name: NF20765_low_13
Description: NF20765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20765_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 31126678 - 31126478
Alignment:
| Q |
22 |
catggaactaatatgtcgtcagttacagccttacacgtttgtgtgcttcgaaactttcaaaacacctctttgctcttcaaaacaccttcttcacccggtt |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31126678 |
catggaactaatatgtcgtcagttacggccttacacgtttgtgtgctacaaaactttcaaaacacctctttgctcttcaaaacaccttcttcacccggtt |
31126579 |
T |
 |
| Q |
122 |
tttaactcccaatgaaccatatcactttgcatttctcttttgctacatctcttctccaacacgacacgtaagttttctaattattttttggggggaattt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31126578 |
tttaactcccaatgaaccatatcactttgcatttctcttttgctacatctcttctccaacacgacacgtaagttttctaattatttttttgggggaattt |
31126479 |
T |
 |
| Q |
222 |
t |
222 |
Q |
| |
|
| |
|
|
| T |
31126478 |
t |
31126478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 31128253 - 31128222
Alignment:
| Q |
1 |
cgtttgttttataaaactaagcatggaactaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31128253 |
cgtttgttttataaaactaagcatggaactaa |
31128222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University