View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20766_high_4 (Length: 205)

Name: NF20766_high_4
Description: NF20766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20766_high_4
NF20766_high_4
[»] chr8 (1 HSPs)
chr8 (1-205)||(31009349-31009553)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 31009349 - 31009553
Alignment:
1 tgcttctgcttttctctgtttcatttctcatttaccattgcatgatgctccttatatacactcgtcgtaggcttgaatctgtcgtagggttccccaaaat 100  Q
    ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
31009349 tgcttatgcttttctctgtttcatttctcatttaccactgcatgatgctccttatatacactcgtcgtaggcttgaatccgtcgtagggttccccaaaat 31009448  T
101 aaattcttttggtgatttaggctatgcaacaagtggccattttggaagattgtgcgttgatattatggtttttcttatgcaatgtggtttttgtgttagc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
31009449 aaattcttttggtgatttaggctatgcaacaagtggccattttggaagattgtgcgttgatatcatggtttttcttatgcaatgtggtttttgtgttagc 31009548  T
201 tacct 205  Q
    |||||    
31009549 tacct 31009553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University