View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20766_low_4 (Length: 211)
Name: NF20766_low_4
Description: NF20766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20766_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 28143358 - 28143175
Alignment:
| Q |
12 |
ataattctcatatctccaaacgaatgcaatgctgggctagaagaaatgatatcaactata--catgaccaatttcacatccatggcaacttatccattca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143358 |
ataattctcatatctccaaacgaatgcaatgctgggctagaagaaatgatatcaactatatacatgaccaatttcacatccatggcaacttatccattca |
28143259 |
T |
|
| Q |
110 |
ttgtcacatcaaaagcacaagttttaacaaaaccttgcatctctatgaatgaatctatgattttccaccaaggaatgattcatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28143258 |
ttgtcacatcaaaagcacaagttttaacaaaaccttgcatctctatgaatgaatctatgattttccaccaaggaatgattcatg |
28143175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University