View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20766_low_5 (Length: 205)
Name: NF20766_low_5
Description: NF20766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20766_low_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 31009349 - 31009553
Alignment:
| Q |
1 |
tgcttctgcttttctctgtttcatttctcatttaccattgcatgatgctccttatatacactcgtcgtaggcttgaatctgtcgtagggttccccaaaat |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31009349 |
tgcttatgcttttctctgtttcatttctcatttaccactgcatgatgctccttatatacactcgtcgtaggcttgaatccgtcgtagggttccccaaaat |
31009448 |
T |
|
| Q |
101 |
aaattcttttggtgatttaggctatgcaacaagtggccattttggaagattgtgcgttgatattatggtttttcttatgcaatgtggtttttgtgttagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009449 |
aaattcttttggtgatttaggctatgcaacaagtggccattttggaagattgtgcgttgatatcatggtttttcttatgcaatgtggtttttgtgttagc |
31009548 |
T |
|
| Q |
201 |
tacct |
205 |
Q |
| |
|
||||| |
|
|
| T |
31009549 |
tacct |
31009553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University