View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20767_high_3 (Length: 339)
Name: NF20767_high_3
Description: NF20767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20767_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 50 - 320
Target Start/End: Original strand, 18389341 - 18389611
Alignment:
| Q |
50 |
cccgaccattttccgaagtttccttgcattttgaaagtaaaattaaaatgtttcaggacaaaacaaatccttaatttgtaagatcaaagttcaatgtttc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18389341 |
cccgaccattttccgaagtttccttgcattttgaaagtaaaattaaaatgtttcaggacaaaacaaatccttaatttgtaagatcaaagttcaatgtttc |
18389440 |
T |
 |
| Q |
150 |
tggcagcatcactataatggtttcttctagtgttaactcggcgcttccagtaaaccattccaatgaaacctaatatggcagctgccataagtgtacctat |
249 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
18389441 |
tggcagcatcactataacggtttcttctaatgttaactcggcgcttccagcaaaccattccaatgaaacctaatatggcagctcccagaagtgtacctat |
18389540 |
T |
 |
| Q |
250 |
tactatccccgccttttgaccgccacttagacccgatgagcctccttgaccagccacagtaggttccggtt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18389541 |
tactatccccgccttttgaccgccacttagacccgatgagcctccttgaccagccgcagtaggttccggtt |
18389611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University