View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20767_low_1 (Length: 374)
Name: NF20767_low_1
Description: NF20767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20767_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 42392399 - 42392028
Alignment:
| Q |
1 |
tggccatgtgtattgttagtagtgttgcgggaaagaggttcatacca-ggtgttgagtgacctaatggatatacttcttgttaagttgttataactagga |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42392399 |
tggccatgtgtattgttagcagtgttgcgggaaagaggttcataccaaggtgttgagtgacgtaatggttatacttcttgttaagttgttataactagga |
42392300 |
T |
 |
| Q |
100 |
gtgtgcatggttcataaaccaaaccaatctatatccaatttatggtttggtttcttaaactgtttcagaaaaaaccaa-nnnnnnnacgaagcagttcag |
198 |
Q |
| |
|
|||||||||||||||||| |||||||| | |||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||| |
|
|
| T |
42392299 |
gtgtgcatggttcataaatcaaaccaaaccatattcaatttatggtttggtttcttaacctgtttcagaaaaaaccaattttttttacgaaatagttcaa |
42392200 |
T |
 |
| Q |
199 |
gtttgctttgggtccggttcagaaccggtttgtgtt---nnnnnnngcagtttatttattttaccagtttctcaaacagtttccatggcttcccgtctta |
295 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| || || ||||||| ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
42392199 |
gtttgttttgggtccggttcagaactggtttgcattaaaaaaaaaagcggtttattcattttaccagtttctcaaacagttttcatggcttcccttctta |
42392100 |
T |
 |
| Q |
296 |
gcttcttgaagtttatcttgccttttctaaggttgttttaaggatgttagttctaggtcattttgatgatgt |
367 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392099 |
gcttcttgaagtttatcttgccttgtctaaggtagttttaaggatgttagttctaggtcattttgatgatgt |
42392028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University