View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20767_low_8 (Length: 224)
Name: NF20767_low_8
Description: NF20767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20767_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 37 - 209
Target Start/End: Complemental strand, 29340823 - 29340652
Alignment:
| Q |
37 |
catataatgcttatgctgattatgcaaggcatttaagcaatattatataatgaggaagtgaa-tgagagcggggtcatgggaactgcactaaactacgga |
135 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29340823 |
catataatgcttatgatgattatgcaaggcatttaaacaatattata--atgaggaagtgaagtgagagcggggtcatgggaactgcactaaactacgga |
29340726 |
T |
 |
| Q |
136 |
aacatggacttgtctcttgctgccatgaccaaaaggaagagtctcgctttgtcacgtgccatgccatttctgtg |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29340725 |
aacatggacctgtctcttgctgccatgaccaaaaggaagagcctcgctttgtcacgtgccatgccatttctgtg |
29340652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University