View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20768_high_1 (Length: 629)
Name: NF20768_high_1
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20768_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 3e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 413 - 612
Target Start/End: Complemental strand, 12858303 - 12858095
Alignment:
| Q |
413 |
gttagtgtactaaagatgaaaacttcgtaatggaaattgtgcattacatttatgtttattttt------tcttacgaaaataaatttattgcatttcatt |
506 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
12858303 |
gttagtgtactaaagatgaaaacttcgtaatggaaattgtgcattccatttatttttatttttattttttcttacaaaaataaatttattgcatttcatt |
12858204 |
T |
 |
| Q |
507 |
caagagaatatcctcaactagtgtgaaaacgagatgcacgtgtta---tatcagcgactccatttgcttgtctcctaatacaacttaccctacagtttgt |
603 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||| ||||||| |||| |||||||||| ||||||||||||||||| || ||||||| |
|
|
| T |
12858203 |
caagagaatatcatcaactagtgtgaaaacgagatgctcgtgttaaactatcagcaactcgatttgcttgtttcctaatacaacttaccataaagtttgt |
12858104 |
T |
 |
| Q |
604 |
attttgatg |
612 |
Q |
| |
|
||||||||| |
|
|
| T |
12858103 |
attttgatg |
12858095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University