View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20768_low_10 (Length: 405)
Name: NF20768_low_10
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20768_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 9 - 386
Target Start/End: Complemental strand, 30371455 - 30371078
Alignment:
| Q |
9 |
agcaaaggtaatgaaaatagatggagaaaccttcaagctaaaaactccagctaaagcaaacgatgtagttaaacactatcctggtcatgctcttttggat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371455 |
agcaaaggtaatgaaaatagatggagaaactttcaagctaaaaactccagctaaagcaaacgatgtagttaaacactatcctggtcatgctcttttggat |
30371356 |
T |
 |
| Q |
109 |
tcacaagcagtgaagcattttggtcttagggctaaaccacttgaacctcaccaacaactcaaggctaagaaaatctatttcttagttgagctaccaaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371355 |
tcacaagcagtgaagcattttggtcttagggctaaaccacttgaacctcaccaacaactcaaggctaagaaaatctatttcttagttgagctaccaaaag |
30371256 |
T |
 |
| Q |
209 |
ttcagtctcaaccattgccgaggagggtgcgatccagtggattacacccttcatgtggcatgaacgctactgagaggctcgacttattgatgctatcgaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
30371255 |
ttcagtctcaaccattgccgaggagggtgcgatccagtggattacacccttcatgtggcatgaacgctactgagaggctcgactttttgatgttatcgaa |
30371156 |
T |
 |
| Q |
309 |
acgttctgtttcggatcttccttcggtgaagcggtccaatctaggggatgatgggcctggtttagttcgtgatgggtc |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30371155 |
acgttctgtttcggatcttccttcggtgaagcggtccaatctaggtgatgatgggcctggtttagttcgtgatgggtc |
30371078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University