View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20768_low_11 (Length: 373)
Name: NF20768_low_11
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20768_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 36 - 357
Target Start/End: Complemental strand, 9615329 - 9615008
Alignment:
| Q |
36 |
attttcttctcatatattggtttgtggcggtttgtacatggaaattgattgcaaaaatattttgatttggttccaaaatatattggatattcagcttcaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9615329 |
attttcttctcatatattggtttgtggcggtttgtacatggaaattggttgcaaaaatattttgatttggttccaaaatatattggatattcagcttcaa |
9615230 |
T |
|
| Q |
136 |
tttatgtttcgtaaagcaagatttggttggtttttattgctggctatgggctttttggatcaacagaaggttctagtatctaagtttcctggttctataa |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9615229 |
tttatgtttcgtaaagtaagatttggttggtttttattgctggctatgggctttttggatcaacagaaggttctagtatctaagtttcctggttctataa |
9615130 |
T |
|
| Q |
236 |
atattattcagtacaaaggagttctccacactcaatcaaattgcaattacaagcnnnnnnncttcttctaccttcatatttattgcgattacctcacaat |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9615129 |
atattattcagtacaaaggagttctccacactcaatcaaattgcaattacaagctttttttcttcttctaccttcatatctattgcgattacctcacaat |
9615030 |
T |
|
| Q |
336 |
ggcctccaagttccctgctaac |
357 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9615029 |
ggcctccaagttccctgctaac |
9615008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 54 - 158
Target Start/End: Complemental strand, 19916762 - 19916657
Alignment:
| Q |
54 |
ggtttgtggcggtttgtacatggaaattgatt-gcaaaaatattttgatttggttccaaaatatattggatattcagcttcaatttatgtttcgtaaagc |
152 |
Q |
| |
|
||||| ||| |||||| |||||||||||| || |||||||||| | ||||||| |||||||||||||| ||||| | ||||||||||||||| ||||| |
|
|
| T |
19916762 |
ggtttatggtggtttgcacatggaaattgctttgcaaaaatatatatatttggtcccaaaatatattggttattcggtttcaatttatgtttcataaagt |
19916663 |
T |
|
| Q |
153 |
aagatt |
158 |
Q |
| |
|
|||||| |
|
|
| T |
19916662 |
aagatt |
19916657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University