View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20768_low_26 (Length: 248)
Name: NF20768_low_26
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20768_low_26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 27509346 - 27509098
Alignment:
| Q |
11 |
aatatccttattaaggctgcatcaattttatttagtgaagatcttaagaacagttatgcatttgcatgcctcacacgttaataattcaactttattagta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27509346 |
aatatccttattaaggctgcatcaattttagttagtgaagatcttaagaacagttatgcatttgcatgcctcacacgttaataattcaactttattagta |
27509247 |
T |
|
| Q |
111 |
gtattttggattgtagtcctcattcactggtctcatttccat------------tgctgaatctctcgttcgtgctaaatttcagtaactgttcagacat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27509246 |
gtattttggattgtagtcctcattcactggtctcatttccattgctttattgcttgctgaatctctcgttcgtgctaaatttcagtaactgttcag-cac |
27509148 |
T |
|
| Q |
199 |
ataatgatgaatgatgaaaaccactagccatgtttttccataaactaggt |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
27509147 |
ataatgatgaatgatgaaaaacactagccatgtttttccataaaataggt |
27509098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University