View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20768_low_30 (Length: 216)
Name: NF20768_low_30
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20768_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 1325423 - 1325237
Alignment:
| Q |
18 |
aatactagagaatgaaatataatagagtaagttaggaattaggaccatgacaattgcatctcttgctgccaatgcaacaatatctgcacaagaaaccact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1325423 |
aatactagagaatgaaatataatagagtaagttaggaattaggaccatgacaattgcatctctagctgccaatgcaacaatatctgcacaagaaaccact |
1325324 |
T |
 |
| Q |
118 |
cctggacaggatgcttctaattgtgccttggctctttctatcacttcaaatcctttaacacctgcatgtggatctgcattcttctct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
1325323 |
cctggacaggatgcttctaattgtgccttggctctttctatcacttcaaatcctttaacacctgcatgtggaaatgcagtcttctct |
1325237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University