View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20768_low_30 (Length: 216)

Name: NF20768_low_30
Description: NF20768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20768_low_30
NF20768_low_30
[»] chr2 (1 HSPs)
chr2 (18-204)||(1325237-1325423)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 1325423 - 1325237
Alignment:
18 aatactagagaatgaaatataatagagtaagttaggaattaggaccatgacaattgcatctcttgctgccaatgcaacaatatctgcacaagaaaccact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
1325423 aatactagagaatgaaatataatagagtaagttaggaattaggaccatgacaattgcatctctagctgccaatgcaacaatatctgcacaagaaaccact 1325324  T
118 cctggacaggatgcttctaattgtgccttggctctttctatcacttcaaatcctttaacacctgcatgtggatctgcattcttctct 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||| ||||||||    
1325323 cctggacaggatgcttctaattgtgccttggctctttctatcacttcaaatcctttaacacctgcatgtggaaatgcagtcttctct 1325237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University