View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2076_high_17 (Length: 226)
Name: NF2076_high_17
Description: NF2076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2076_high_17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 226
Target Start/End: Original strand, 17778893 - 17779093
Alignment:
| Q |
26 |
aaacttcgattttaagtgtttgtggttgtaaatataatttatggacatatttaacttgtcttttaacatgcaggaatcatgggctatctgtagaatattc |
125 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17778893 |
aaacttcggttttaagtgtttgtggttgtaaatataatttatggacatctttaacttgtcttttaacatgcaggaatcatgggctatctgtagaatattc |
17778992 |
T |
 |
| Q |
126 |
aagaaaacaaattctacggctcaaagagctttgtctcactcttgggtttcttccctatctgaaacaagaacctctaatatgctaaccaaaaatcaagaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17778993 |
aagaaaacaaattctacggctcaaagagctttgtctcactcttgggtttcttccctatctgaaacaagaacctctaatatgctaaccaaaaatcaagaaa |
17779092 |
T |
 |
| Q |
226 |
t |
226 |
Q |
| |
|
| |
|
|
| T |
17779093 |
t |
17779093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University