View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2076_low_11 (Length: 338)
Name: NF2076_low_11
Description: NF2076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2076_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 47996081 - 47996277
Alignment:
| Q |
18 |
aaaagcaataccgaggtgaaaaagatgggtaagattgacgaggatcaaccttgtcattttgagaacaatcaaattggtttcaaaaccaatcttttgcatt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47996081 |
aaaagcaatactgaggtgaaaaagatgggtaagattgacgaggatcaaccttgtcattttgagagcaatcaaattggtttcaaaaccaatcttttgcatt |
47996180 |
T |
 |
| Q |
118 |
tgattccaacaagaaggagcagtgctgccaagaatccaaacctacgtatatataacatcatcaatgaagattgaagggtgacatgaagaaaataaag |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47996181 |
tgattccatcaagaaggagcagtgctgccaagaatccaaacgtacgtatatataacatcatcaatgaagattgaagggtgacatgaagaaaataaag |
47996277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 244 - 330
Target Start/End: Original strand, 47996316 - 47996405
Alignment:
| Q |
244 |
ggtgagtgagcatgcacgtgctagaataatttgagcgattatcaagatcaagagt---gtagactctagattaataattcaacctttgct |
330 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47996316 |
ggtgagtgagcatgcacttgctggaataatttgagcgattatcaagatcaagagtgtagtagactctagattaataattcaacctttgct |
47996405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University