View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2076_low_14 (Length: 269)
Name: NF2076_low_14
Description: NF2076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2076_low_14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 9300261 - 9300512
Alignment:
| Q |
17 |
ctcactaatgatcatcctatgaggactagagccaagtctggcattgtgcagcctagactgaagcccactttgttacttactatgaatctaaaattgctaa |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9300261 |
ctcactaatgatcgtcctatgaggactagagccaagtctggctttgtgcagcctagactgaagcccactttgttccttactatgaatctaaaattgctaa |
9300360 |
T |
|
| Q |
117 |
acaagcactctataaacccccaatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgggattgggtttctctcccaacaaa |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
9300361 |
acaagcactctataaacccc-aatggcatgctactatgcaagaagagtttgattcattagaaagaaataacacttgagatggggtttctctcccaacaaa |
9300459 |
T |
|
| Q |
217 |
aagaaccgccatatataggatgcaaatgggtattcagagtcaaagaaaatgtt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9300460 |
aagaaccgccatatataggatgcaaatgggtattcagagtcaaagaaaatgtt |
9300512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University