View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2076_low_21 (Length: 222)
Name: NF2076_low_21
Description: NF2076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2076_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 98 - 213
Target Start/End: Original strand, 13908226 - 13908341
Alignment:
| Q |
98 |
atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtctaacaataattctctctctaatcaaattaactcttgtttttggtgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
13908226 |
atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtttaacaataattctctctctaatcaaattaactattgcttttggtgt |
13908325 |
T |
 |
| Q |
198 |
agttttagatgatgtc |
213 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
13908326 |
agttttatatgatgtc |
13908341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University