View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2076_low_21 (Length: 222)

Name: NF2076_low_21
Description: NF2076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2076_low_21
NF2076_low_21
[»] chr8 (1 HSPs)
chr8 (98-213)||(13908226-13908341)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 98 - 213
Target Start/End: Original strand, 13908226 - 13908341
Alignment:
98 atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtctaacaataattctctctctaatcaaattaactcttgtttttggtgt 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||    
13908226 atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtttaacaataattctctctctaatcaaattaactattgcttttggtgt 13908325  T
198 agttttagatgatgtc 213  Q
    ||||||| ||||||||    
13908326 agttttatatgatgtc 13908341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University