View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20770_high_10 (Length: 326)
Name: NF20770_high_10
Description: NF20770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20770_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 34 - 308
Target Start/End: Original strand, 4065618 - 4065892
Alignment:
| Q |
34 |
gaaaaatatgacttgtccttcgttgtggcgcgaagtcacctttatacagagggattcggttgtaacggagtctgtgaaatcaggcagagaagacgggagt |
133 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065618 |
gaaaaatgtgacttgtccttcgctgtggcgcgaagtcacctttatacagagggattcggttgtaacggagtctgtgaaatcaggcagagaagacgggagt |
4065717 |
T |
 |
| Q |
134 |
tcggtagagaatatcaatagtccttattgatggagttgcgctcttgtgcagtaaggaacacagaagtcttctttcctaccttaggtggcaaggattatgg |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4065718 |
tcggtagagaatatcaatagtcctgattgatggagttgcgctcttgtgcggtaaggaacacagaagtcttctttcccaccttaggtggcaaggattatgg |
4065817 |
T |
 |
| Q |
234 |
gtcactagaccgccagtccaaaacactttgtcttagtgagtttattcacatagaacaagatccttgtaaaaatga |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065818 |
gtcactagaccgccagtccaaaacactttgtcttagtgagtttattcacatagaacaagatccttgtaaaaatga |
4065892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 12923735 - 12923798
Alignment:
| Q |
21 |
gtggaaaagtggtgaaaaatatgacttgtccttcgttgtggcgcgaagtcacctttatacagagg |
85 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||||| | ||| |||||||||| ||||| |
|
|
| T |
12923735 |
gtggaaaagtggtgaaaaatgtgtcttgt-cttcgttgtggcacaaagccacctttatatagagg |
12923798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University