View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20770_high_19 (Length: 201)
Name: NF20770_high_19
Description: NF20770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20770_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 43428766 - 43428929
Alignment:
| Q |
15 |
gagatgaatacaacttggtggatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattctggtgactagagaaa |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43428766 |
gagatgaatacaacttggtgaatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattc-ggtgact--cgaaa |
43428862 |
T |
|
| Q |
115 |
caacaagagtaa--nnnnnnnnnccgcttatctccaaattctgatatcgagtgagttggttccttct |
179 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43428863 |
caacaagagtaatttttttttttccgcttatctccaaattctgatatcgagtgagttggttccttct |
43428929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University