View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20770_low_21 (Length: 201)

Name: NF20770_low_21
Description: NF20770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20770_low_21
NF20770_low_21
[»] chr8 (1 HSPs)
chr8 (15-179)||(43428766-43428929)


Alignment Details
Target: chr8 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 43428766 - 43428929
Alignment:
15 gagatgaatacaacttggtggatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattctggtgactagagaaa 114  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||   ||||    
43428766 gagatgaatacaacttggtgaatgggggaaaagatagaatgagtagaaagagagaatccaaatctcccacgaccagtttggattc-ggtgact--cgaaa 43428862  T
115 caacaagagtaa--nnnnnnnnnccgcttatctccaaattctgatatcgagtgagttggttccttct 179  Q
    ||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||    
43428863 caacaagagtaatttttttttttccgcttatctccaaattctgatatcgagtgagttggttccttct 43428929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University