View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20772_high_3 (Length: 352)

Name: NF20772_high_3
Description: NF20772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20772_high_3
NF20772_high_3
[»] chr1 (2 HSPs)
chr1 (1-160)||(44552893-44553052)
chr1 (232-335)||(44553124-44553227)
[»] chr6 (1 HSPs)
chr6 (279-314)||(12683483-12683518)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 44552893 - 44553052
Alignment:
1 ctcctcgacaactcctgcactatctatgacccaccaacaaactcatttttgtttatattcttttgggccctttttgcagctgctccttttcactagctac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44552893 ctcctcgacaactcctgcactatctatgacccaccaacaaactcatttttgtttatattcttttgggccctttttgcagctgctccttttcactagctac 44552992  T
101 tactatactcaagctgatgcacccactgcaggcttgtttgccactacttcaaagttacca 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44552993 tactatactcaagctgatgcacccactgcaggcttgtttgccactacttcaaagttacca 44553052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 232 - 335
Target Start/End: Original strand, 44553124 - 44553227
Alignment:
232 ctgtccacggttctgctccatgttatcttctccctgctgaggtggccgccattgctgctccggctgaaccatcaacggtgccaccatgttctccggttgc 331  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
44553124 ctgtccacggttctgctccatgttatcttctccctgctgaggtggccgccattgctgctccggctgaaccatcaacggtgccgccatgttctccggttgc 44553223  T
332 acca 335  Q
    ||||    
44553224 acca 44553227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 279 - 314
Target Start/End: Complemental strand, 12683518 - 12683483
Alignment:
279 gccattgctgctccggctgaaccatcaacggtgcca 314  Q
    |||| |||||||||||||||||||||||||||||||    
12683518 gccactgctgctccggctgaaccatcaacggtgcca 12683483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University