View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20772_high_6 (Length: 297)
Name: NF20772_high_6
Description: NF20772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20772_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 10482316 - 10482583
Alignment:
| Q |
8 |
ccaagaatatcttttgcataagaggaaacatgactatatgttttaacataaaaggggaggaaaacataattcaaatttcttttaaggttgaggattattt |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
10482316 |
ccaataatatcttttgcataagaggaaacatgactatatgttttaacataaaaggggaggaaagcatagttcaagcttcttttagggttgaggattattt |
10482415 |
T |
 |
| Q |
108 |
taccctagagatgggcaattcttgaatttaaacatacctatttatttatgtaggtcacttagtcttttctcttaacaaatatgataattttnnnnnnnnn |
207 |
Q |
| |
|
|||| || |||||||||||| || ||||||||||||| ||||||||||||| ||||||| |||||||| |||| |||||||||| |||| |
|
|
| T |
10482416 |
taccttaaagatgggcaatttttatatttaaacatacccatttatttatgtatgtcactttctcttttcttttaaaaaatatgatatttttttaaaaatt |
10482515 |
T |
 |
| Q |
208 |
nnnnnnnnnngtttggcaaacacacttgcacctaagacccaaggctagaaatgagtttagtcgaactt |
275 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
10482516 |
gataaaaaaagtttggcaaacacacttgcacgtaagacccaagtctagaaatgagttgagtcaaactt |
10482583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University