View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20772_low_6 (Length: 297)

Name: NF20772_low_6
Description: NF20772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20772_low_6
NF20772_low_6
[»] chr1 (1 HSPs)
chr1 (8-275)||(10482316-10482583)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 8 - 275
Target Start/End: Original strand, 10482316 - 10482583
Alignment:
8 ccaagaatatcttttgcataagaggaaacatgactatatgttttaacataaaaggggaggaaaacataattcaaatttcttttaaggttgaggattattt 107  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||  |||||||| |||||||||||||||    
10482316 ccaataatatcttttgcataagaggaaacatgactatatgttttaacataaaaggggaggaaagcatagttcaagcttcttttagggttgaggattattt 10482415  T
108 taccctagagatgggcaattcttgaatttaaacatacctatttatttatgtaggtcacttagtcttttctcttaacaaatatgataattttnnnnnnnnn 207  Q
    |||| || |||||||||||| ||  ||||||||||||| ||||||||||||| |||||||  |||||||| |||| |||||||||| ||||             
10482416 taccttaaagatgggcaatttttatatttaaacatacccatttatttatgtatgtcactttctcttttcttttaaaaaatatgatatttttttaaaaatt 10482515  T
208 nnnnnnnnnngtttggcaaacacacttgcacctaagacccaaggctagaaatgagtttagtcgaactt 275  Q
              ||||||||||||||||||||| ||||||||||| ||||||||||||| |||| |||||    
10482516 gataaaaaaagtttggcaaacacacttgcacgtaagacccaagtctagaaatgagttgagtcaaactt 10482583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University