View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20772_low_7 (Length: 280)
Name: NF20772_low_7
Description: NF20772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20772_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 24454709 - 24454813
Alignment:
| Q |
3 |
cttatagtgtaatgtgatgatgggaggctctataaaaatgagcatttattgattgatactttcaaaacaactaattcatttgtattggaacacacacggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24454709 |
cttatagtgtaatgtgatgatgggaggctctataaaaatgagcatttattgattgatactttcaaaacaactaattcatttgtattggaacacacacggt |
24454808 |
T |
 |
| Q |
103 |
tccaa |
107 |
Q |
| |
|
||||| |
|
|
| T |
24454809 |
tccaa |
24454813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 135
Target Start/End: Complemental strand, 27541486 - 27541354
Alignment:
| Q |
3 |
cttatagtgtaatgtgatgatgggaggctctataaaaatgagcatttattgattgatactttcaaaacaactaattcatttgtattggaacacacacggt |
102 |
Q |
| |
|
|||||||||||||||| | ||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| || |
|
|
| T |
27541486 |
cttatagtgtaatgtgcttatgggagactcttgaaaaatgagcatttattgattgatactttcaacacaactaattcatttgtattggaacatacaccgt |
27541387 |
T |
 |
| Q |
103 |
tccaannnnnnnnagtgaaatcagaatcactac |
135 |
Q |
| |
|
| ||| |||||||||||||||||||| |
|
|
| T |
27541386 |
ttcaattttttttagtgaaatcagaatcactac |
27541354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 211 - 263
Target Start/End: Complemental strand, 27541275 - 27541222
Alignment:
| Q |
211 |
gtcgctgttcatcaacaaaaaa-ctcacccgtccagatctccacttccggccac |
263 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
27541275 |
gtcgctgttcatcaacaaaaaaactcacccgtccagatttccacttccggccac |
27541222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University