View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20773_low_3 (Length: 283)
Name: NF20773_low_3
Description: NF20773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20773_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 46996319 - 46996570
Alignment:
| Q |
17 |
agcacagagagatctcgtttcttatgaagacannnnnnnn---aactattcttatgatgatgataaaaagagtcggctgccaaaattgaataagaaagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46996319 |
agcacagagagatctcgtttcttatgaagacatttttttttttaactattcttatgatgatgataaaaagagtcggctgccaaaattgaataagaaagaa |
46996418 |
T |
 |
| Q |
114 |
ggttcgtcgaagttgttgtgagtagaacgtgaatcccacccaaaaaaggaataaccacctaccctgcnnnnnnnnnnnnnnntccaccctgcttttatta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46996419 |
ggttcgtcgaagttgttgtgagtagaacgtgaatcccactcaaaaaaggaataaccacctaccctgctttttttaaagaaaatccaccctgcttttatta |
46996518 |
T |
 |
| Q |
214 |
ttgcttaatttttaaatatagattcaacaaaatgaggatcaaatgttcatct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46996519 |
ttgcttaatttttaaatatagattcaacaaaatgaggatcaaatgttcatct |
46996570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 239
Target Start/End: Original strand, 46999571 - 46999604
Alignment:
| Q |
206 |
ttttattattgcttaatttttaaatatagattca |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
46999571 |
ttttattattgcttaatttctaaatatagattca |
46999604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University