View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_33 (Length: 332)
Name: NF20775_low_33
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 121 - 316
Target Start/End: Complemental strand, 19469645 - 19469448
Alignment:
| Q |
121 |
aaaagaataatcatattacnnnnnnncattaataaagacgtaacactaacattgtgtattctaactttttt--agtacctcaatcttttacataattttt |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19469645 |
aaaagaataatcatattactttttttcattaataatgatgtaacactaacattgtgtattctaacttttttttagtacctcaatcttttacataattttt |
19469546 |
T |
|
| Q |
219 |
tgttttatgatagctgacacaatttggatgtggaagtttggcacttgcttctcattacaaccactgcatactagatggtatagcagtaagagagtttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19469545 |
tgttttatgatagctgacacaatttggatgtggaagtttggcacttgcttctcattacaaccactgcatactagatggtaaagcagtaagagagtttg |
19469448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 13 - 51
Target Start/End: Complemental strand, 19469760 - 19469722
Alignment:
| Q |
13 |
attctctttaaaacgttttatgactctaaattgtgcgag |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19469760 |
attctctttaaaacgttttatgactctaaattgtgcgag |
19469722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 19415258 - 19415222
Alignment:
| Q |
15 |
tctctttaaaacgttttatgactctaaattgtgcgag |
51 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
19415258 |
tctctttaaaatgttttatgactctaaattatgcgag |
19415222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University