View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_52 (Length: 251)
Name: NF20775_low_52
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 38 - 168
Target Start/End: Complemental strand, 1577056 - 1576927
Alignment:
| Q |
38 |
tatctaccgttttggtaaaaccaaatgtatcttcggtagacaattgtgaatactaatccttttgtaatttatgagatacgttgcatctagttaaacaatt |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1577056 |
tatctaccgttttggtaaa-ccaaatgtatcttctatagacaattgtgaatactaatccttttgagatttatgagatacgttgcatctagttaaacaatt |
1576958 |
T |
 |
| Q |
138 |
ttattattttgattgtaaataaaaatgtttt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1576957 |
ttattattttgattgtaaataaaaatgtttt |
1576927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 1576929 - 1576885
Alignment:
| Q |
207 |
ttttgaaaaaagaaaatctatataataaaacatactgtaatattt |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1576929 |
ttttgaaaaaagaaaatctatgtaataaaacatactgtaatattt |
1576885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University