View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20775_low_52 (Length: 251)

Name: NF20775_low_52
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20775_low_52
NF20775_low_52
[»] chr8 (2 HSPs)
chr8 (38-168)||(1576927-1577056)
chr8 (207-251)||(1576885-1576929)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 38 - 168
Target Start/End: Complemental strand, 1577056 - 1576927
Alignment:
38 tatctaccgttttggtaaaaccaaatgtatcttcggtagacaattgtgaatactaatccttttgtaatttatgagatacgttgcatctagttaaacaatt 137  Q
    ||||||||||||||||||| ||||||||||||||  ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
1577056 tatctaccgttttggtaaa-ccaaatgtatcttctatagacaattgtgaatactaatccttttgagatttatgagatacgttgcatctagttaaacaatt 1576958  T
138 ttattattttgattgtaaataaaaatgtttt 168  Q
    |||||||||||||||||||||||||||||||    
1576957 ttattattttgattgtaaataaaaatgtttt 1576927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 1576929 - 1576885
Alignment:
207 ttttgaaaaaagaaaatctatataataaaacatactgtaatattt 251  Q
    ||||||||||||||||||||| |||||||||||||||||||||||    
1576929 ttttgaaaaaagaaaatctatgtaataaaacatactgtaatattt 1576885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University