View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_68 (Length: 238)
Name: NF20775_low_68
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 17253481 - 17253693
Alignment:
| Q |
9 |
acatcatcaacaggaatatcactatctggatcattatcaggaaaccctacaaacccaccaagaggaaaagctctaattgaatattcaacattttttgcat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17253481 |
acatcatcaacaggaatatcactatctggatcattatcaggaaaccctacaaacccaccaagaggaaaagctctaattgaatattcaacattttttgcat |
17253580 |
T |
 |
| Q |
109 |
taaacttagctaaaattggaccaaacccaacagcaaatttactcacatgaatcccttgaagagaagcagcaagaaaatgaccactttcatgaacaacaat |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17253581 |
taaacttagctaaaattggaccgaacccaacagcaaatttactcacatgaatcccttgaagagaagcagcaagaaaatgaccactttcatgaacaacaat |
17253680 |
T |
 |
| Q |
209 |
gatagctgtcaat |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17253681 |
gatagctgtcaat |
17253693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University