View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20775_low_68 (Length: 238)

Name: NF20775_low_68
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20775_low_68
NF20775_low_68
[»] chr4 (1 HSPs)
chr4 (9-221)||(17253481-17253693)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 17253481 - 17253693
Alignment:
9 acatcatcaacaggaatatcactatctggatcattatcaggaaaccctacaaacccaccaagaggaaaagctctaattgaatattcaacattttttgcat 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17253481 acatcatcaacaggaatatcactatctggatcattatcaggaaaccctacaaacccaccaagaggaaaagctctaattgaatattcaacattttttgcat 17253580  T
109 taaacttagctaaaattggaccaaacccaacagcaaatttactcacatgaatcccttgaagagaagcagcaagaaaatgaccactttcatgaacaacaat 208  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17253581 taaacttagctaaaattggaccgaacccaacagcaaatttactcacatgaatcccttgaagagaagcagcaagaaaatgaccactttcatgaacaacaat 17253680  T
209 gatagctgtcaat 221  Q
    |||||||||||||    
17253681 gatagctgtcaat 17253693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University