View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_70 (Length: 237)
Name: NF20775_low_70
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 48396323 - 48396094
Alignment:
| Q |
1 |
tgaaagatagttgagcaatgctttgaaaagtttatggtggtggtatttgcaaatattttgacactcaagtaagtaagcaaagctaaggtataaggtatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48396323 |
tgaaagatagttgagcaatgctttgaaaagtttatggtggtggtatttgcaaatattttgacactcaagtaagtaagcaaagctgaggtataaggtatgt |
48396224 |
T |
 |
| Q |
101 |
ggggttaaaattgtgtactttgcgatctgtttcaagggctacttttagtgaggtagaggatcccataaggagttaggtgttaatggtt--------acac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
48396223 |
ggggttaaaattgtgtactttgcgatctgtttcaagggctacttttagtgaggtagaggatcccctaaggagttaggtgttaatggttggattgaaacac |
48396124 |
T |
 |
| Q |
193 |
tagaaaagttgtcttgatattggttcaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48396123 |
tagaaaagttgtcttgatattggttcaaaa |
48396094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University