View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_76 (Length: 217)
Name: NF20775_low_76
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 32261161 - 32261346
Alignment:
| Q |
16 |
aaaatcaggcaaaggttgtttttagcaaaacatggattggacatatattctatttacttgggacaaatttacagtgagaatcaaatcaaaattacaaatt |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32261161 |
aaaatcaagcaaaggttgtttttagcaaaacatggattggacatatattctatttacttggtacaaatttacagtgagaatcaaatcaaaattgcaaatt |
32261260 |
T |
|
| Q |
116 |
tgaaagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261261 |
tgaaagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataat |
32261346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University