View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20775_low_77 (Length: 209)
Name: NF20775_low_77
Description: NF20775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20775_low_77 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 2331691 - 2331887
Alignment:
| Q |
10 |
ataatactaagaaacaacaatgatcaccaccaataatggtgaaaaacagttaaaagggaaaaccaacacaagaaaggagaatacttaggtatcgttccct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331691 |
ataatactaagaaacaacaatgatcaccaccaat---ggtgaaaaacagttaaaagggaaaaccaacacaagaaaggagaatacttaggtatcgttccct |
2331787 |
T |
 |
| Q |
110 |
gcacactattcgctcagttcttcacatgaatgtacctaaacattgtcgtttaaaaatgatttggattaatggcggtttgggagatttaataatttatttt |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
2331788 |
acacactattcgctcagtttttcacatgaatgcacctaaacattgtcgtttaaaaatgatttggattaatggcggttgggcagttttaataatttatttt |
2331887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University