View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20776_low_4 (Length: 330)
Name: NF20776_low_4
Description: NF20776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20776_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 43823597 - 43823812
Alignment:
| Q |
13 |
catcatcagaggcaacttcatggatgatatcagagtcatcaatgaaaacatcattgttgtcttcgtcttcatcgttgttgaattcatcatcactatgatg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823597 |
catcgtcagaggcaacttcatggatgatatcagagtcatcaatgaaaacatcattgttgtcttcgtcttcatcgttgttgaattcatcatcactatgatg |
43823696 |
T |
 |
| Q |
113 |
atttggatcactcattgtattgcttaaaattttcaagtctataaacctataagacaaacaaagtaagacaaaattattgaataacgaagttataaattaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43823697 |
atttggatcactcattgtattgcttaaaattttcaagtctataaacctataagacaaacaaagtaagacaaaattattgaataactaagttataaattaa |
43823796 |
T |
 |
| Q |
213 |
aatatcaatcatcttt |
228 |
Q |
| |
|
||| | ||| |||||| |
|
|
| T |
43823797 |
aatcttaattatcttt |
43823812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 266 - 315
Target Start/End: Original strand, 43823809 - 43823858
Alignment:
| Q |
266 |
ctttgtagaaattggaaaagaggagaatatgaatgaagcagtgggaaaag |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823809 |
ctttgtagaaatcggaaaagaggagaatatgaatgaagcagtgggaaaag |
43823858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University